1-20 OF 28 RESULTS FOR

Enterobacter

Results shown limited to content with bounding coordinates.
Save search
Follow your search
Access your saved searches in your account
Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Image
Reduced Se solid-phase concentrations from Enterobacter cloacae experiments categorized by aggregate section. Each bar represents the mean of six extractions measurements (only four for core sections) from two aggregates run with 0.4 and 0.8 mmol L−1 SeO42− input solution, respectively (0.25 and 0.5 mmol L−1 for ferrihydrite experiments). Error bars reflect standard deviations around the mean.

Reduced Se solid-phase concentrations from Enterobacter cloacae experimen... Available to Purchase

Published: 01 May 2012
Fig. 4. Reduced Se solid-phase concentrations from Enterobacter cloacae experiments categorized by aggregate section. Each bar represents the mean of six extractions measurements (only four for core sections) from two aggregates run with 0.4 and 0.8 mmol L −1 SeO 4 2− input solution
Image

Bacterial biofilm species studied (modified from Caflisch et al., 2018 ) ... Available to Purchase

Published: 01 October 2021
, prosthetic joint infection Streptococcus dysgalactiae IDRL-10052 Knee, prosthetic joint infection Pseudomonas aeruginosa IDRL-11465* Urine Pseudomonas aeruginosa IDRL-10628* Unknown Enterobacter cloacae IDRL-10306* Knee Enterobacter cloacae IDRL-10375* Unknown
Journal Article

Soil-Aggregate-Scale Heterogeneity in Microbial Selenium Reduction Available to Purchase

Matteo Kausch, Peter Ng, Juyoung Ha, Céline Pallud
Published: 01 May 2012
Vadose Zone Journal (2012) 11 (2): vzj2011.0101.
DOI: https://doi.org/10.2136/vzj2011.0101
...Fig. 4. Reduced Se solid-phase concentrations from Enterobacter cloacae experiments categorized by aggregate section. Each bar represents the mean of six extractions measurements (only four for core sections) from two aggregates run with 0.4 and 0.8 mmol L −1 SeO 4 2− input solution...
FIGURES | View All (4)
View PDF for article title, Soil-Aggregate-Scale Heterogeneity in Microbial Selenium Reduction
Purchase
Add to Citation Manager for Soil-Aggregate-Scale Heterogeneity in Microbial Selenium Reduction
Journal Article

Geomicrobial Exploration of Sulfur Oxidizing Bacteria Indigenous to Kapurdi and Jalipa Lignite Mine Site, Rajasthan Available to Purchase

Prashasti Bhandari, Sangeeta Choudhary
Published: 01 November 2023
Jour. Geol. Soc. India (2023) 99 (11): 1586–1594.
DOI: https://doi.org/10.1007/s12594-023-2510-y
... (OP788112), Bacillus sp. strain KO2 (OP788113), Bacillus sp.strain KO3 (OP788114), Enterobacter sp. strain KO4, KO5, KO6, KO9 (OP788115, OP788116, OP788117, OP788120), Leclercia sp. Strain KO7 (OP788118), Pantoea sp. strain KO8 (OP788119), and Rhodococcussp.strain KO10 (OP788121). The culture condition...
FIGURES | View All (5)
View PDF for article title, Geomicrobial Exploration of Sulfur Oxidizing Bacteria Indigenous to Kapurdi and Jalipa Lignite Mine Site, Rajasthan
Purchase
Add to Citation Manager for Geomicrobial Exploration of Sulfur Oxidizing Bacteria Indigenous to Kapurdi and Jalipa Lignite Mine Site, Rajasthan
Image

Bacterial species studied in biofilm form, including strain, source, and su... Available to Purchase

Published: 15 February 2019
aeruginosa IDRL- 11465 Urine Resistant to cefepime, deftazidime, deftazidime/avibactam, meropenem, and aztronam Pseudomona aeruginosa IDRL- 10628 Unknown bla vm-2 ; resistant to ceftazidime and ceftazidime/avibactam Enterobacter cloacae IDRL- 10306 Knee (prosthetic joint) Resistant
Image
Ratio of aggregate to input solution SeO42− concentrations by solid matrix and aeration conditions. Values >1 indicate that SeO42− partitioned to the solid phase from the solution (i.e., sorption), and values <1 indicate that consumption of SeO42− inside aggregates exceeded diffusive supply from the surrounding solution. Values below the detection limit were set to zero. The box plot shows the full range of measurements (fences), the range between first and third quartile (bar), and the median value (horizontal line inside bar). A single outlier is shown as a circle (Enterobacter cloacae, plain quartz sand matrix, oxic conditions).

Ratio of aggregate to input solution SeO 4 2− concentrations by solid mat... Available to Purchase

Published: 01 May 2012
( Enterobacter cloacae , plain quartz sand matrix, oxic conditions).
Journal Article

Characterization and Bioremediation of a Weathered Oil Sludge Available to Purchase

W. R. Giles, Jr., K. D. Kriel, J. R. Stewart
Published: 01 June 2001
Environmental Geosciences (2001) 8 (2): 110–122.
DOI: https://doi.org/10.1046/j.1526-0984.2001.82003.x
... Bacterial consortia from The University of Texas at Tyler Bacterial Culture Collection. 1 2 3 4 5 Bacillus polymyxa Enterobacter intermedius Pseudomonas aeruginosa Acinetobacter calcoaceticus Bacillus megaterium Bacillus cereus Proteus mirabilis Alcaligenes entrophus...
FIGURES | View All (7)
View PDF for article title, Characterization and Bioremediation of a Weathered Oil Sludge
Purchase
Add to Citation Manager for Characterization and Bioremediation of a Weathered Oil Sludge
Journal Article

Bacterially mediated morphogenesis of struvite and its implication for phosphorus recovery Available to Purchase

Han Li, Qi-Zhi Yao, Sheng-Hui Yu, Ya-Rong Huang, Xiang-Dong Chen, Sheng-Quan Fu, Gen-Tao Zhou
Published: 01 February 2017
American Mineralogist (2017) 102 (2): 381–390.
DOI: https://doi.org/10.2138/am-2017-5687
... and Torzewska 2009 , 2010 ; Prywer et al. 2012 ), whereas the prismatic struvite crystals were produced by a metallophilic bacterium Enterobacter sp. ( Sinha et al. 2014 ). Moreover, Sadowski et al. (2014) reported that the struvite mineralized by bacterium Proteus mirabilis has more regular habit than...
FIGURES | View All (6)
View PDF for article title, Bacterially mediated morphogenesis of struvite and its implication for phosphorus recovery
Purchase
Add to Citation Manager for Bacterially mediated morphogenesis of struvite and its implication for phosphorus recovery
Journal Article

Remediation of Chromium and Uranium Contamination by Microbial Activity Available to Purchase

Yangjian Cheng, Hoi-Ying Holman, Zhang Lin
Journal: Elements
Published: 01 April 2012
Elements (2012) 8 (2): 107–112.
DOI: https://doi.org/10.2113/gselements.8.2.107
... or DNA. Detoxifying enzymes protect the cell against oxidative stress and reduce the toxic effects of chromate ( Ramírez-Díaz et al. 2008 ). (4) Bacteria can form extracellular capsules to obstruct the passage of Cr(VI) into the cell. As an example, we have observed capsule formation in Enterobacter...
FIGURES | View All (7)
View PDF for article title, Remediation of Chromium and Uranium Contamination by Microbial Activity
Purchase
Add to Citation Manager for Remediation of Chromium and Uranium Contamination by Microbial Activity
Image
SEM images of the precipitates collected from various treatments. (a) Enterobacter sp. (San) cells were adsorbed on the montmorillonite (Mt) surface in beef extract peptone medium after 24 h of incubation (the initial composite before the treatment of San + hydroxylapatite (HAp) + Mt). Morphology of HAp particles in (a) control treatment, (b) San + HAp, (c) Hap + Mt and (d) San + HAp + Mt. Morphology of San adsorbed on the surface of Mt in San + HAp + Mt at (e) 24 h and (f) 72 h of incubation. (g) Concentrations of Ca and P analysed using inductively coupled plasma during 72 h of incubation (n = 3). A statistical analysis of P concentration was performed between San + HAp and San + HAp + Mt at the same incubation times, and the asterisk indicates a significant difference at p < 0.05 (reprinted with permission from Su et al., 2019, Elsevier B.V.). (h) SEM images of Aspergillus niger after 5 days of incubation with montmorillonite (Mon) (scale bar represents 10 μm). Energy-dispersive spectrometry showed the chemical distribution of (i) Al, (j) Si and (k) P in the presence of various clay minerals. (l) The acid sorption (pure oxalic acid at 50 ppm) ability of kaolinite (Kao), montmorillonite (Mon) and palygorskite (Pal) based on high-performance liquid chromatography analysis. Different lower-case letters indicate significant differences among the treatments (p < 0.05) (reprinted with permission from Zhang et al., 2019b, Elsevier B.V.).

SEM images of the precipitates collected from various treatments. (a) Ente... Available to Purchase

Published: 24 August 2022
Fig. 5. SEM images of the precipitates collected from various treatments. (a) Enterobacter sp. (San) cells were adsorbed on the montmorillonite (Mt) surface in beef extract peptone medium after 24 h of incubation (the initial composite before the treatment of San + hydroxylapatite (HAp) + Mt
Journal Article

Preliminary Evaluation of Natural Antibacterial Clays for Treating Wound Infections Available to Purchase

Lynda B. Williams, Suzannah M. Schmidt-Malan, Robin Patel
Published: 01 October 2021
Clays and Clay Minerals (2021) 69 (5): 589–602.
DOI: https://doi.org/10.1007/s42860-021-00164-3
..., prosthetic joint infection Streptococcus dysgalactiae IDRL-10052 Knee, prosthetic joint infection Pseudomonas aeruginosa IDRL-11465* Urine Pseudomonas aeruginosa IDRL-10628* Unknown Enterobacter cloacae IDRL-10306* Knee Enterobacter cloacae IDRL-10375* Unknown...
FIGURES | View All (12)
View PDF for article title, Preliminary Evaluation of Natural Antibacterial Clays for Treating Wound Infections
Purchase
Add to Citation Manager for Preliminary Evaluation of Natural Antibacterial Clays for Treating Wound Infections
Journal Article

Noninvasive Quantification of Green Fluorescent Protein Labeled Escherichia coli in a Dynamic Capillary Fringe by Fluorescence Intensity Available to Purchase

Daniel Jost, Josef Winter, Claudia Gallert
Published: 01 May 2015
Vadose Zone Journal (2015) 14 (5): vzj2014.03.0028.
DOI: https://doi.org/10.2136/vzj2014.03.0028
... Enterobacter aerogenes under anaerobic conditions by aerobic fluorescence recovery . FEMS Microbiol. Lett. 249 : 211 – 218 . doi:10.1016/j.femsle.2005.05.051 Zhao Y. Xiang S. Dai X. Yang K. . 2013 . A simplified diphenylamine colorimetric method for growth quantification . Appl...
FIGURES | View All (8)
View PDF for article title, Noninvasive Quantification of Green Fluorescent Protein Labeled Escherichia coli in a Dynamic Capillary Fringe by Fluorescence Intensity
Purchase
Add to Citation Manager for Noninvasive Quantification of Green Fluorescent Protein Labeled Escherichia coli in a Dynamic Capillary Fringe by Fluorescence Intensity
Journal Article

Natural Antibacterial Clays: Historical Uses and Modern Advances Available to Purchase

Lynda B. Williams
Published: 15 February 2019
Clays and Clay Minerals (2019) 67 (1): 7–24.
DOI: https://doi.org/10.1007/s42860-018-0002-8
... aeruginosa IDRL- 11465 Urine Resistant to cefepime, deftazidime, deftazidime/avibactam, meropenem, and aztronam Pseudomona aeruginosa IDRL- 10628 Unknown bla vm-2 ; resistant to ceftazidime and ceftazidime/avibactam Enterobacter cloacae IDRL- 10306 Knee (prosthetic joint) Resistant...
FIGURES | View All (20)
View PDF for article title, Natural Antibacterial Clays: Historical Uses and Modern Advances
Purchase
Add to Citation Manager for Natural Antibacterial Clays: Historical Uses and Modern Advances
Journal Article

Construction and Performance Evaluation of Dual-Metabolite Oil-Producing Engineering Bacteria Suitable for Low-Permeability Reservoir Open Access

Zhao Yang, Guo Zhihua, Wu JingChun, Shi Hanqing
Journal: Lithosphere
Publisher: GSW
Published: 17 August 2022
Lithosphere (2022) 2022 (Special 12): 8427896.
DOI: https://doi.org/10.2113/2022/8427896
... by protoplast fusion of Enterobacter cloacae and thermophilic geobacter, which produced extracellular polysaccharides [ 13 ]. The temperature-adapted growth value of ZR3 was increased from 30°C to 45°C. Although genetic engineering has been applied in the field of microbial oil recovery, there are few reports...
FIGURES | View All (11)
View PDF for article title, Construction and Performance Evaluation of Dual-Metabolite Oil-Producing Engineering Bacteria Suitable for Low-Permeability Reservoir
Add to Citation Manager for Construction and Performance Evaluation of Dual-Metabolite Oil-Producing Engineering Bacteria Suitable for Low-Permeability Reservoir
Journal Article

Using the AC/TC Ratio to Evaluate Fecal Inputs in a Karst Groundwater Basin Available to Purchase

JAMES W. WARD, THOMAS M. REED, ALAN E. FRYAR, GAIL M. BRION
Published: 01 May 2009
Environmental & Engineering Geoscience (2009) 15 (2): 57–65.
DOI: https://doi.org/10.2113/gseegeosci.15.2.57
... that ferment lactose within 24 hours at 35°C ( APHA, 1998 ). The TC group includes the most common intestinal organisms, E. coli and Citrobacter freundii , the less common intestinal organism Klebsiella pneumoniae , and Enterobacter aerogenes , an organism not commonly associated with the intestinal tract...
FIGURES
View PDF for article title, Using the AC/TC Ratio to Evaluate Fecal Inputs in a Karst Groundwater Basin
Purchase
Add to Citation Manager for Using the AC/TC Ratio to Evaluate Fecal Inputs in a Karst Groundwater Basin
Journal Article

Degradation of Diffuse Pesticide Contaminants: Screening for Microbial Potential Using a Functional Gene Microarray All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Available to Purchase

Jost Liebich, Thorsten Wachtmeister, Jizhong Zhou, Peter Burauel
Published: 01 August 2009
Vadose Zone Journal (2009) 8 (3): 703–710.
DOI: https://doi.org/10.2136/vzj2008.0072
... ATCGACGGCTTCGCGCGCTTGCTGGACGACTGCAGACACAGCCTGAAAGC 22126223_10 Yersinia pestis KIM atzA CTGCGGGGCGCGTTTGACTCTGAACAAAAATATTGGGATATCGCTATGCC 228:13022196_1045 Enterobacter cloacae trzC CGCATGCTGGGATTCCCCTCACTTTTAGGCGTCGTGGAAGGGGCAGTCGC 254:11890745_1306 Acidovorax avenae subsp. citrulli atzA...
FIGURES | View All (4)
View PDF for article title, Degradation of Diffuse Pesticide Contaminants: Screening for Microbial Potential Using a Functional Gene Microarray All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Purchase
Add to Citation Manager for Degradation of Diffuse Pesticide Contaminants: Screening for Microbial Potential Using a Functional Gene Microarray All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Journal Article

Microbial Arsenic Metabolism and Reaction Energetics Available to Purchase

Jan P. Amend, Chad Saltikov, Guang-Sin Lu, Jaime Hernandez
Published: 01 January 2014
Reviews in Mineralogy and Geochemistry (2014) 79 (1): 391–433.
DOI: https://doi.org/10.2138/rmg.2014.79.7
...] 168 Enterobacter sp. str. AR-8 Groundwater, Choushui River alluvial fan, Taiwan (1.6 μM) FAN HAR (10 mM) Lactate/O 2 /Lactate 25 7 arsBC no arrA, aoxB [50] 169 Enterobacter sp. str. MC010 Old tin mine area, Thailand A HAR (1–20 mM) Lactate/O 2 /Lactate 30 7 NR [51] 170...
FIGURES | View All (4)
View PDF for article title, Microbial Arsenic Metabolism and Reaction Energetics
Purchase
Add to Citation Manager for Microbial Arsenic Metabolism and Reaction Energetics
Journal Article

Bacterial production of vanadium ferrite spinel (Fe,V) 3 O 4 nanoparticles Available to Purchase

Victoria S Coker, Gerrit van der Laan, Neil D Telling, Jonathan R Lloyd, James M Byrne, Elke Arenholz, Richard AD Pattrick
Published: 01 July 2020
Mineralogical Magazine (2020) 84 (4): 554–562.
DOI: https://doi.org/10.1180/mgm.2020.55
..., 1993 ; Yurkova and Lyalikova, 1991 ). Recently a mixed anaerobic culture was identified as being able to reduce V(V) to V(IV), with Enterobacter and Lactococcus species implicated in this process (Zhang et al. , 2015 ). Using a combination of infrared, Mössbauer and X-ray spectroscopies...
FIGURES | View All (6)
View PDF for article title, Bacterial production of vanadium ferrite spinel (Fe,V) 3 O 4 nanoparticles
Purchase
Add to Citation Manager for Bacterial production of vanadium ferrite spinel (Fe,V) 3 O 4 nanoparticles
Journal Article

Barium and High Explosives in a Semiarid Alluvial System, Cañon de Valle, New Mexico Available to Purchase

Kevin D. Reid, Steven L. Reneau, Brent D. Newman, Donald D. Hickmott
Published: 01 August 2005
Vadose Zone Journal (2005) 4 (3): 744–759.
DOI: https://doi.org/10.2136/vzj2004.0174
... , I.B. , A.J. Daugulis , and C. Dubois . 2003 . The use of Enterobacter cloacae ATCC 43560 in the development of a two-phase partitioning bioreactor for the destruction of hexahydro-1,3,5-trinitro-1,3,5-s-triazine (RDX) . J. Biotechnol . 100 : 65 – 75 . Rainwater , K. , C...
FIGURES | View All (11)
View PDF for article title, Barium and High Explosives in a Semiarid Alluvial System, Cañon de Valle, New Mexico
Purchase
Add to Citation Manager for Barium and High Explosives in a Semiarid Alluvial System, Cañon de Valle, New Mexico
Journal Article

Performance of a pilot-scale constructed wetland treatment system for selenium, arsenic, and low-molecular-weight organics in simulated fresh produced water Available to Purchase

Michael M. Spacil, John H. Rodgers, Jr., James W. Castle, Wayne Y. Chao
Published: 01 September 2011
Environmental Geosciences (2011) 18 (3): 145–156.
DOI: https://doi.org/10.1306/eg.01281110020
... : Planta , v.  206 , p.  284 – 292 , doi:10.1007/s004250050402. Zhang , Y. , and W. T. Frankenberger Jr. , 2005 , Removal of selenium from river water by a microbial community enhanced with Enterobacter taylorae in organic carbon-coated sand columns : Science of the Total Environment...
FIGURES
View PDF for article title, Performance of a pilot-scale constructed wetland treatment system for selenium, arsenic, and low-molecular-weight organics in simulated fresh produced water
Purchase
Add to Citation Manager for Performance of a pilot-scale constructed wetland treatment system for selenium, arsenic, and low-molecular-weight organics in simulated fresh produced water